柬埔寨龙血树SSR分子标记的开发为其保护遗传学研究奠定基础----中国科学院西双版纳热带植物园.pdf

American Journal of Botany: e91–e93. 2010. AJB Primer Notes & Protocols in the Plant Sciences ISOLATION AND CHARACTERIZATION OF MICROSATELLITE MARKERS IN AN ENDANGERED SPECIES DRACAENA CAMBODIANA (LILIACEAE)1 Lu Zhang2,3 and Qiao-Ming Li2,4 2Laboratory of Plant Phylogenetics and Conservation, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Kunming,Yunnan 650223, China; and Key Laboratory of Tropical Forest Ecology, Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences, Menglun, Yunnan 666303, P.R. China; 3The Graduate School of the Chinese Academy of Sciences, Beijing 100049, China • Premise of the study: The development of microsatellite primers in the endangered species Dracaena cambodiana will be the foundation for genetic and conservation studies of D. cambodiana and several Dracaena species. • Methods and Results: A total of 26 microsatellite markers were developed in Chinese populations of D. cambodiana, using the Fast Isolation by AFLP of Sequences Containing Repeats (FIASCO) protocol. Among them, sixteen primer pairs generated polymorphic loci (fourteen of them successfully amplified in other four Dracaena species) and ten primer pairs produced monomorphic loci. • Conclusions: These microsatellite markers could be used in the further investigation of population genetics of D. cambodiana and other Dracaena species. Key words: cross-species amplification; Dracaena; endangered species; microsatellite markers. The genus Dracaena includes more than 50 species, which are mainly distributed in tropical and subtropical regions of Asia and Africa. Dracaena cambodiana is a narrow-distributed species, which is found in Yunnan, Guangxi, and Hainan provinces in China, Laos, Vietnam, Thailand and Cambodia (Chen and Turland, 2000). In 2001, D. cambodiana was listed as an endangered species due to its highly restricted distribution and overexploitation (Fu, 1992). Considering its medicinal, ornamental and ecological values, an appropriate conservation program is urgently needed to prevent further loss of D. cambodiana. Therefore, it is essential to develop molecular markers for the population genetic analysis of D. cambodiana to provide essential information for the development of a management and conservation strategy. Due to the reproducibility, multiallelic nature, codominant inheritance, relative abundance and wide genome coverage, microsatellite markers have proven to be highly efficient molecular tools for population genetic studies. In the current study, we (1) developed microsatellite markers for D. cambodiana and assessed the polymorphism of these loci in 22 samples collected from 11 geographically distinct populations (N = 2 for each) distributed in Guangxi, Yunnan, and Hainan Provinces in China, and (2) performed cross-amplification tests in four other Dracaena species (D. thalioides, D. reflexa, D. marginata, and 1 D. gracilis). Voucher specimens were deposited in Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences. METHODS AND RESULTS Total genomic DNA was extracted from leaf tissues of D. cambodiana using a modified cetyltrimethyl ammonium bromide (CTAB) method (Doyle and Doyle, 1987). A dinucleotide-enriched microsatellite genomic library was constructed and screened using a fast isolation by AFLP of sequences containing repeats (FIASCO) protocol with some modifications (Zane et al., 2002). Approximately 250 ng of total genomic DNA was digested with Mse I (New England BioLabs, Beverly, MA), and then ligated to the adapters (5′ - TACTCAGGACTCAT - 3′/5′ - GACGATGAGTCCTGAG - 3′) using T4 DNA ligase (Fermentas, Burlington, Ontario, Canada) and diluted (1:10). Then 5 μL digestion-ligation DNA fragments were amplified with 1 μL Mse I-N primers (5′ - GATGAGTCCTGAGTAAN - 3′) (25 μM) in a 20 μL volume, using a thermal cycling program of initial denaturation of 3 min at 95°C, followed by 20 cycles of 30 s at 94°C, 1 min at 53°C, 1 min at 72°C, and a final extension at 72°C for 10 min. Approximately 500–1000 ng of amplified DNA was hybridized with 200 pmol of 5′- biotinylated (AG)15 oligonucleotide in a total volume of 250 μL of SSC 4.2 × and SDS 0.07%. The mixture was incubated at 95°C for 5 min, followed by annealing at 58°C for 2 h and cooled to room temperature. The hybridization mixture was enriched using 600 μL of streptavidin-coated beads (Promega, Madison, WI), and three nonstringent and three stringent washes were carried out following Zane et al. (2002). DNA containing repeats were amplified by 30 cycles with Mse I-N primers. The polymerase chain reaction (PCR) product was purified with the E.Z.N.A.1 Gel Extraction Kit (Omega, Bio-Tek, Winooski, VT) and ligated into a pGEM-T plasmid vector (Promega, Madison, WI) and transformed into DH5α competent cells. Recombinant clones were detected by PCR amplification using T7/SP6 and (AG)10 as primers at the following thermal cycling conditions: initial denaturation of 3 min at 95°C, followed by 35 cycles of 30 s at 94°C, 30 s at 55°C, 60 s at 72°C, and a final extension at 72°C for 8 min. A total of 100 clones with foreign inserts and relatively long flanking regions were sequenced using an ABI PRISM 3730 DNA sequence analyzer (Applied Biosystems, Foster City, CA). A total of 74 sequences containing microsatellites were obtained by SSR Hunter 1.3 software huntering (Li and Wan, 2005) and then subjected to primer designing using both PRIMER 3 (Rozen and Skaletsky, 2000) and software oligo 6.0 (National Biosciences). About 40 primer pairs were designed and Manuscript received 7 July 2010; revision accepted 29 July 2010. This study was supported by the Funds of the Chinese Academy of Sciences for Key Topics in Innovation Engineering (Grant No. KSCX2YW-Z-002). The authors thank Dr. Yang (Kunming Institute of Botany, Chinese Academy of Sciences) for his kindly help in the experiments, and Dr. Dayanandan (Concordia University, Canada) for his valuable suggestions and comments on the manuscript. 4 Author for correspondence: lqm@xtbg.ac.cn doi:10.3732/ajb.1000245 American Journal of Botany: e91–e93, 2010; http://www.amjbot.org/ © 2010 Botanical Society of America e91 e92 Table 1. [Vol. 0 American Journal of Botany Characteristics of the 16 polymorphic and 10 monomorphic microsatellite markers developed in Dracaena cambodiana. Locus Primer sequence(5′→3′) Repeat motif Ta(°C) No. of cycles Allele size (bp) GenBank Accession No. DC003 F:AGAAAGGGAGGTGACAGG R:GTCAAAGAGCCCAAACAA F:GTTTCTAGTTCAAGAACCCAA R:TTCCTCCTCTTTCTCATCCT F:CCTGAGTAATGGGACTATA R:TGTGAGACCCAAATGCTA F:CAGGATCACAAGTGCTAT R:CCTGAGTAAGGAGTACAA F:GCAAGGGTTGATGATAGA R:TGAGAACAGCAATGATTAG F:AGCGTATTCAAAATGTCC R:TCTGTTGCTATCGTGATC F:TCGGTCTTAGCTTTCTCC R:AGTAAGGTTAGGGCTTGA F:GAGAATCAGGTTATGGTC R:GTAATCCCCAATTACTCG F:AACCCCTTACTTGTCCAC R:CCAACTTACCTTTTGCTAC F:TGGAGCTAAGAAGAATAGAA R:GTAAGGAGCAGGAGGTGT F:TAAGGGAGATCCAAGGAA R:AACCTCCAATTTGAAACC F:CGCTTTGCTTTGTGAATC R:CTCCAACTATGGCACCTC F:AACAACAGCAGCAACGAC R:GGCTTGGCTTCTGGGAAA F:CCCACTAACTCAAAGAAG R:AACACGAATGTGAAAAGG F:GGGGAATTTCCGTTGCTT R:CTGGACGTGAGTATTTGG F:TAGAAAGTTTGTAGCCAA R:GAGATTGTGAGCCATAAA F:AATAAGGGCAGAGGAGGA R:CGTGGGATTTGTACTTGC F:GCCCTGTATCTGCCACTT R:CACCTTCAACATGCACCC F:TTAGGGCTGGTTTGCTCA R:GTAAAACGGGCCGGAAGG F:ATTGTGGATTGGATGAAG R:GCTAGTACCAAACAGGAA F:GACTGGCTAAAGAAATGGA R:TGGGAGGTAGCTGAAAGA F:AAGACTGGGAGAAGAGCA R:TGAGTAAGAAATAAAACGGA F:GAGGCACATCGGCAAGTT R:CTTCTTCCATCTCCCACC F:TCCCATAAATGCTCCTCA R:TCAAGCTATGCATCCAAC F:GTAAGAAGAAAAGAGGAAGA R:AGGGAATCTGTCACTTGT F:TGGTTTGGATGCAGGGAG R:CGTGACACCACCAGAAGAA (AG)10..(AG)5A(AG)5 54 30 169–212 HM215604 (AG)16 54 30 188–200 HM215605 (CT)9 46 30 182–206 HM215606 (GA)10 50 35 222–231 HM215607 (AG)13 50 30 160–184 HM215608 (TCA)6TG(GA)9 48 35 140–158 HM215609 (CT)6C2AC4T(TC)12 48 30 166–202 HM215610 (AG)12 50 30 152–170 HM215611 (AG)12 52 35 121–137 HM215612 (GT)8(GA)8 48 30 109–117 HM215613 (TG)5A(GT)8(GA)11 46 30 229–258 HM215614 (TC)18ACT(CA)11 60 30 315–342 HM215615 (CT)13 52 30 159–167 HM215616 (GA)23 48 30 187–213 HM215617 (GA)8..(AG)23 54 40 165–195 HM215618 (CT)9(CA)9 50 30 172–184 HM215619 (AAT)5..(AG)15 50 30 167 HM581792 (TC)10 54 35 184 HM581793 (AG)9 54 40 439 HM581794 (CT)6..(TC)12 48 30 273 HM581795 (GA)7GC(GA)7 50 35 197 HM581796 (GA)5..(GA)8 54 30 414 HM581797 (AG)8..(TG)8(GA)6 56 40 358 HM581798 (CT)9 48 35 162 HM581799 (GA)20 52 40 146 HM581800 (GA)8 52 35 224 HM581801 DC006 DC128 DC136 DC138 DC140 DC317 DC318 DC435 DC437 DC448 DC456 DC460 DC501 DC516 DC616 DC121 DC124 DC305 DC319 DC402 DC415 DC450 DC465 DC522 DC623 Ta, annealing temperature. used for the subsequent test. These primers are all free of dimer and hairpin structure in 3′-termini, the length of each primer was 18–20 bp, and the value of Tm are ranged from 48°C to 60°C. The final SSR-PCR system used in screening was optimized by an orthogonal design experiment, and four levels of five factors (Mg2+, dNTP, Primer, Taq polymerase, and DNA template) have been tested separately in this system. The results demonstrated the reaction efficiency was affected by these factors. Based on the results, a stable, productive and reproducible PCR system was obtained: 20 μL system containing 10 ng template DNA, 0.4 μM of forward and reverse primers, 2.5 mM of MgCl2, 0.2 mM of dNTPs, 2 μL 10×Taq buffer and 1.0 unit of Taq polymerase (Takara, Dalian, Liaoning, China). Cycling conditions were 94°C for 5 min followed by 30–40 cycles at 94°C for 30 s, 46°C–60°C for 30 s (number of cycles and annealing temperatures were locus- specific; see Table 1), and 72°C for 1 min, with a final extension step of 8 min at 72°C. The PCR product was then separated on a 8% denaturing polyacrylamide gel and visualized by silver staining. A 25 bp DNA ladder (Promega, Madison, WI) was used as standard for scoring. A total of 26 of the 40 primers successfully amplified DNA fragments, with 16 showing polymorphism and 10 showing monomorphism. Preliminary population genetics analyses for these polymorphic loci were performed using GENEPOP version 4.0 (Rousset, 2008). The number of alleles per locus (A) was 6 to 14 with an average of 9.188, the expected heterozygosity (HE) ranged from 0.668 to 0.940 and the observed heterozygosity (HO) varied from 0.333 to 0.875 (Table 2) . Eight of the 16 polymorphic loci departed significantly from the Hardy-Weinberg equilibrium (P < 0.01), which was due to excess of homozygosites. Analysis of errors using Micro-Checker version 2.2.3 (van Oosterhout et al., 2004) October 2010] AJB Primer Notes & Protocols – Dracaena cambodiana microsatellites Table 2. Results of initial primer screening in 22 individuals of Dracaena cambodiana for 16 polymorphic loci. Number of alleles (A), observed heterozygosity (HO), expected heterozygosity (HE), fixation index (F) and P -values for the Hardy-Weinberg equilibrium (HWE) test are given for each marker. Locus A Ho HE F HWE DC003 DC006 DC128 DC136 DC138 DC140 DC317 DC318 DC435 DC437 DC448 DC456 DC460 DC501 DC516 DC616 7 11 7 9 13 14 13 7 8 8 7 6 6 11 14 6 0.632 0.773 0.333 0.650 0.875 0.632 0.750 0.682 0.727 0.563 0.625 0.533 0.632 0.364 0.773 0.688 0.859 0.906 0.756 0.892 0.897 0.935 0.899 0.668 0.889 0.865 0.853 0.770 0.817 0.940 0.918 0.806 0.275 0.127 0.597 0.314 −0.007 0.390 0.144 −0.044 0.163 0.442 0.413 0.350 0.298 0.795 0.138 0.404 0.020 0.005* 0.000* 0.000* 0.050 0.000* 0.053 0.480 0.272 0.000* 0.000* 0.047 0.001* 0.000* 0.047 0.177 *Indicates the observed heterozygosity is departed significantly from the expected heterozygosity under Hardy-Weinberg equilibrium (P < 0.01). Voucher specimens of 11 Dracaena cambodiana natural populations: DCJC1568; DCPX1569; DCDF1570; DCSY1571; DCJG1572; DCMY1573; DCZK1574; DCML1575; DCXBL1576; DCMX1577; DCYW1578 were all deposited in Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences. suggested that these loci are likely to contain null alleles. No significant linkage disequilibrium was detected between locus pairs except for locus pair DC136 and DC140, DC435 and DC501, DC435 and DC516, DC003 and DC616, DC448 and DC616 (P < 0.01). These 16 loci further investigated for cross-species amplification in other four Dracaena (D. thalioides, D. reflexa, D. marginata, D. gracilis) species using five individuals for each species. In this test, 14 loci successfully amplified products, and 10 primer pairs among them showed polymorphism in at least one of these four Dracaena species (Table 3). CONCLUSIONS A total of 26 primer pairs in D. cambodiana could be used to assess the genetic diversity and genetic structure of Dracaena species for further evaluation and research. LITERATURE CITED Chen, S. C., and N. J. Turland. 2000. Flora of China 24: 215–217. Science Press, Beijing, China. e93 Table 3. Cross-amplification of 16 polymorphic microsatellite loci across other four Dracaena species. Locus Dracaena thalioides (N = 5) Dracaena reflexa (N = 5) Dracaena marginata (N = 5) Dracaena gracilis (N = 5) DC003 DC006 DC128 DC136 DC138 DC140 DC317 DC318 DC435 DC437 DC448 DC456 DC460 DC501 DC516 DC616 127, 137 198 N 190 N N N N P(6)/110-128 N N 320, 328 P(3)/141-204 P(4)/166-191 160 138 141 P(3)/196-206 N 208, 210 140, 148 N 106, 108 176 110 N N 330, 332 141 161, 187 162, 164 156 143 204 184 204, 206 146 N 109, 111 176 118 N 196 332 137, 141 166, 180 144, 146 158 131, 143 204, 206 184 208, 210 N N 104, 106 176 104, 106 N 196 N 161, 164 168, 174 154, 156 158 n, Sample size; N, no amplification; P, polymorphic amplification, numbers in parentheses showed the number of alleles and the range of product size; Voucher specimen of four Dracaena species: DT1026 (D. thalioides); DR1027 (D. reflexa); DM1028 (D. marginata); DG1029 (D. gracilis) were all deposited in Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences. Doyle, J. J., and J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry 19: 11–15. Fu, L. G. 1992. Red book of Chinese plant—rare and endangered species (Vol. 1). Science Press, Beijing, China. Li, Q., and J. M. Wan. 2005. SSRHunter: Development of a local searching software for SSR sites. Hereditas 27: 808–810. Rousset, F. 2008. GenePop′007: a complete re-implementation of the GenePop software for Windows and Linux. Molecular Ecology Resources 8: 103–106. Rozen, S., and H. J. Skaletsky. 2000. Primer 3 on the WWW for general users and for biologist programmers. In S. Krawetz and S. Misener [eds.], Bioinformatics Methods and Protocols: Methods in Molecular Biology, 365–386. Humana Press, Totowa, New Jersey. Van Oosterhout, C., W. F. Hutchinson, D. P. M. Wills, and P. Shipley. 2004. Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. Zane, L., L. Bargelloni, and T. Patarnellon. 2002. Strategies for microsatellite isolation: a review. Molecular Ecology 11: 1–16.